Our catalogue includes phosphoramidite both containing 5- and 6-isomer of JOE. They have identical spectral characteristics and, in practical terms, there is no difference, which of two isomers is used. However, we have performed real-time PCR using two probes containing either 5- or 6-isomer of JOE to show their interchangeability.
Probes with the following sequences were designed
· Probe #1 [JOE]CAGTGGTGGACCTGACCTGCCG[BHQ1]
· Probe #2 [JOE]CCTGCCTCTACTGGCGCTGCCA[BHQ1]
and synthesized using both isomer forms.
Plasmid samples (10 pg and 1 pg per reaction) with a cloned fragment of human GAPDH gene were used as templates; PCR reaction was performed using PCR/qPCR master mix. GAPDH gene fragment was amplified using the following primer set:
· gapdh-f: GAAGGACTCATGACCACAG
· gapdh-r: AATTCGTTGTCATACCAGG
Amplification was performed on DTprime real-time PCR system. Reactions were run through an initial denaturing period of 95 ˚C for 5 min, followed by 45 cycles of 95 ˚C for 12 sec, 60 ˚C for 15 sec, and 72 ˚C for 20 sec.
As expected, real-time PCR results have shown no significant differences between two isomers of JOE used for the probe synthesis.
Cycle vs. probe/JOE isomer
The plot demonstrates that there is a not significant difference in Ct (~0.5) between 5- and 6-JOE isomers of a single probe and ~1 cycle difference between two probes with different sequences.
Variations of less than 1 cycle can be caused by pipetting errors or well-to-well differences in temperature conditions and measurements.
Values represent the mean ± SE. At the 0.05 level, the two distributions (Ct for 5- and 6-isomer) are not significantly different.
Maximum fluorescence intensity vs. probe/JOE isomer
The plot demonstrates that there is a not significant difference in fluorescence signal (~ 10 %) between 5- and 6-JOE isomers of a single probe.
Variations of fluorescence intensity between two probes are typically related to the probe sequences, purity of the probes, etc.
Values represent the mean ± SE. At the 0.05 level, the two distributions (Maximum fluorescence intensity for 5- and 6-isomer) are not significantly different.

